View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_high_9 (Length: 315)
Name: NF21135_high_9
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 64 - 308
Target Start/End: Complemental strand, 6136685 - 6136441
Alignment:
| Q |
64 |
atattttaaaggaaacatgagaggtttcttcaatacatggggttggctcctcaagccagggaagttcataaccattgaatcgttaatggagctagatccc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6136685 |
atattttaaaggaaacatgagaggtttcttcaatacatggggttggctcctcaagccagggaagttcataaccattgaatcgttaatggagctagatccc |
6136586 |
T |
|
| Q |
164 |
atcaaagagcactacttgtttatggtaggggtcnnnnnnnccaatctcaccacttaagagagtaaaggggagagaatagctttttaaaaataggggggag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
6136585 |
atcaaagagcactacttgtttatggtaggggtctttttttccaatctcaccacttaagagagtaaaagggagagaatagctttttaaaaataggggggag |
6136486 |
T |
|
| Q |
264 |
agaaggaggtatttcttgtcccatttttatttatgtcctttgctt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6136485 |
agaaggaggtatttcttgtcccatttttatttatgtcctttgctt |
6136441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 65
Target Start/End: Complemental strand, 30664211 - 30664165
Alignment:
| Q |
19 |
ttgtatgcttaaccagtgccccgaaggcaccgatcagcatgactcat |
65 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
30664211 |
ttgtatgcttaaccagtgccccgtgggcaccggttagcatgactcat |
30664165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 38128434 - 38128476
Alignment:
| Q |
19 |
ttgtatgcttaaccagtgccccgaaggcaccgatcagcatgac |
61 |
Q |
| |
|
||||||||||||||||||||||| |||||||| | |||||||| |
|
|
| T |
38128434 |
ttgtatgcttaaccagtgccccggaggcaccggttagcatgac |
38128476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 30889474 - 30889432
Alignment:
| Q |
19 |
ttgtatgcttaaccagtgccccgaaggcaccgatcagcatgac |
61 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| |||||||| |
|
|
| T |
30889474 |
ttgtatgcttaaccagtaccccggaggcaccgattagcatgac |
30889432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 37402803 - 37402761
Alignment:
| Q |
19 |
ttgtatgcttaaccagtgccccgaaggcaccgatcagcatgac |
61 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | |||||||| |
|
|
| T |
37402803 |
ttgtatgcttaaccagtgccccgagggcaccggttagcatgac |
37402761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University