View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_low_12 (Length: 308)
Name: NF21135_low_12
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_low_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 19 - 308
Target Start/End: Original strand, 40383268 - 40383557
Alignment:
| Q |
19 |
gtcaagacggtaaaagatggtggccaagattcctccggtaaccagaactgcaccgagacggattccgaataattccggcatccgtcttgagtttagtaga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383268 |
gtcaagacggtaaaagatggtggccaagattcctccggtaaccagaactgcaccgagacggattccgaataattccggcatccgtcttgagtttagtaga |
40383367 |
T |
 |
| Q |
119 |
gaccgttttccaataactgccatttcaatccaaaacggatttgcaaaagtggcaactgaggacgcaattgagttaccgtttccattaccaccattagttc |
218 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
40383368 |
gaccgttttccaataaccgccatttcaatccaaaacggatttgcaaaagtggcaactgaggacgcaattgagttaccgttgccattaccaccgttagttc |
40383467 |
T |
 |
| Q |
219 |
ctgagactaatttccctcttgagatactggcactgatggcgtcttttaacgacattttaggtccgttaacggcagttacagatgctggtt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383468 |
ctgagactaatttccctcttgagatactcgcactgatggcgtcttttaacgacattttaggtccgttaacggcagttacagatgctggtt |
40383557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University