View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21135_low_25 (Length: 240)

Name: NF21135_low_25
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21135_low_25
NF21135_low_25
[»] chr4 (1 HSPs)
chr4 (144-221)||(54088374-54088451)


Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 144 - 221
Target Start/End: Original strand, 54088374 - 54088451
Alignment:
144 tcggcttccacttcaggatcaggatcgggatcagggtcttctggagcaggttctgaagccagctcccatgcaggatct 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
54088374 tcggcttccacttcaggatcaggatcgggatcagggtcttctggagcaggttctgaagccggctcccatgcaggatct 54088451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University