View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_low_25 (Length: 240)
Name: NF21135_low_25
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 144 - 221
Target Start/End: Original strand, 54088374 - 54088451
Alignment:
| Q |
144 |
tcggcttccacttcaggatcaggatcgggatcagggtcttctggagcaggttctgaagccagctcccatgcaggatct |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54088374 |
tcggcttccacttcaggatcaggatcgggatcagggtcttctggagcaggttctgaagccggctcccatgcaggatct |
54088451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University