View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21135_low_33 (Length: 210)
Name: NF21135_low_33
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21135_low_33 |
 |  |
|
| [»] scaffold0193 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0193 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: scaffold0193
Description:
Target: scaffold0193; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 70 - 200
Target Start/End: Complemental strand, 23862 - 23732
Alignment:
| Q |
70 |
aacaatttaaaaatataataaactaatgtgatccctttttcaaaaataaatattagattgtactaggtttagagtatctctagtattctttaaactacga |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| || |
|
|
| T |
23862 |
aacaatttaaaaatataataaactaatgtgatccctttttcaaaaataaatattagattgtactaggtttatagtatctctagttttctttaaactatga |
23763 |
T |
 |
| Q |
170 |
tccattgttcactatattcatatcttctctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23762 |
tccattgttcactatattcatatcttctctt |
23732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University