View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21135_low_33 (Length: 210)

Name: NF21135_low_33
Description: NF21135
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21135_low_33
NF21135_low_33
[»] scaffold0193 (1 HSPs)
scaffold0193 (70-200)||(23732-23862)


Alignment Details
Target: scaffold0193 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: scaffold0193
Description:

Target: scaffold0193; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 70 - 200
Target Start/End: Complemental strand, 23862 - 23732
Alignment:
70 aacaatttaaaaatataataaactaatgtgatccctttttcaaaaataaatattagattgtactaggtttagagtatctctagtattctttaaactacga 169  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||    
23862 aacaatttaaaaatataataaactaatgtgatccctttttcaaaaataaatattagattgtactaggtttatagtatctctagttttctttaaactatga 23763  T
170 tccattgttcactatattcatatcttctctt 200  Q
    |||||||||||||||||||||||||||||||    
23762 tccattgttcactatattcatatcttctctt 23732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University