View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21136_high_5 (Length: 350)
Name: NF21136_high_5
Description: NF21136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21136_high_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 17 - 339
Target Start/End: Original strand, 47697251 - 47697573
Alignment:
| Q |
17 |
caacctagccttgtctaatgctttatcatacagggtgttttagaggcaatcaggattagttgtgctgggtacccaactcgccgtgctttctttgagttta |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47697251 |
caacctagctttgtctaatgctttatcatacagggtgttttagaggcaatcaggattagttgtgctgggtacccaactcgccgtgctttctttgagttta |
47697350 |
T |
 |
| Q |
117 |
taaaccgattttccctccttgccccagaggccacggaaggaaagtaagaactcttctagtaaacttttaagccatgtagaaagttttgtctttatgatat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47697351 |
taaaccgattttccctccttgccccagaggccacggaaggaaagtaagaactcttctagtaaacttttaagccatgtagaaagttttgtctttatgatat |
47697450 |
T |
 |
| Q |
217 |
caaacattttccacccagctaatgtgttttttcacttatggacagccttgatgagaaggctggttgccataagattctagaaaagatggggcttaaagga |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47697451 |
caaacattttccacccagctaatgtgttttttcacttatggacagccttgatgagaaggctggttgccataagattctagaaaagatggggcttaaagga |
47697550 |
T |
 |
| Q |
317 |
tatcaggtactttgaatattcat |
339 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
47697551 |
tatcaggtactttgaataatcat |
47697573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 47 - 177
Target Start/End: Complemental strand, 35826374 - 35826244
Alignment:
| Q |
47 |
cagggtgttttagaggcaatcaggattagttgtgctgggtacccaactcgccgtgctttctttgagtttataaaccgattttccctccttgccccagagg |
146 |
Q |
| |
|
|||||||| ||||| || ||||| || ||||||||||| || || || ||||| |||||||||| ||| | ||| ||||| |||||||||||||||| |
|
|
| T |
35826374 |
cagggtgtattagatgctatcagaatcagttgtgctggctatcctacacgccgccctttctttgaatttgtgaacagatttggtctccttgccccagagg |
35826275 |
T |
 |
| Q |
147 |
ccacggaaggaaagtaagaactcttctagta |
177 |
Q |
| |
|
||| |||| |||||||| |||||| ||||| |
|
|
| T |
35826274 |
ccatagaagcaaagtaagcactcttttagta |
35826244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 280 - 332
Target Start/End: Complemental strand, 35826119 - 35826067
Alignment:
| Q |
280 |
ttgccataagattctagaaaagatggggcttaaaggatatcaggtactttgaa |
332 |
Q |
| |
|
|||||| |||||||| || |||| ||||||||||||||||| |||| |||||| |
|
|
| T |
35826119 |
ttgccaaaagattctggagaagacggggcttaaaggatatcgggtaatttgaa |
35826067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University