View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21136_high_6 (Length: 283)
Name: NF21136_high_6
Description: NF21136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21136_high_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 37098531 - 37098274
Alignment:
| Q |
19 |
ctttcacctttgaatctctcagatccccacctgatgaacaagtcaccgatggtggtgcaacttggtgaaggaccaaaaccctgttcttccactccggtgc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37098531 |
ctttcacctttgaatctctcagatccccacctgatgaacaagtcaccgatggtggtgcaacttggtgaaggaccaaagccctgttcttccactccggtgc |
37098432 |
T |
|
| Q |
119 |
tgtcacaagaacatgtttcacctggtttgagcttggatcattatcaaccgtctgatcaaacactcccactgatcgggaaactaaacaacggccacgatta |
218 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37098431 |
tgtcacgagaacatgcttcagctggtttgagcttggatcattatcaaccgtctgatcaaacactcccactgatcgggaaactaaacaacggccacgatta |
37098332 |
T |
|
| Q |
219 |
tccatctggtgttgaggaaagtggggtacacaaacagcacaacaagctagatcctttg |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37098331 |
tccatctggtgttgaggaaagtggggtacacaaacagcacaacaaactagatcctttg |
37098274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 37092255 - 37092007
Alignment:
| Q |
19 |
ctttcacctttgaatctctcagatccccacctgatgaacaagtcaccgatggtggtgcaacttggtgaaggaccaaaaccctgttcttccactccggtgc |
118 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||| |||||||| |||||||||||| ||||| ||||||||||| |||||||| | |
|
|
| T |
37092255 |
ctttcacctttgcatctctcagatccccacctgattaaccagtcaccggtggtggtgcaacaaggtgatggaccaaaaccttgttcttca---------c |
37092165 |
T |
|
| Q |
119 |
tgtcacaagaacatgtttcacctggtttgagcttggatcattatcaaccgtctgatcaaacactcccactgatcgggaaactaaacaacggccacgatta |
218 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
37092164 |
aatcacaagaacatgtttcagctggtttgagcttggatcgttatcagccgtctgatcaaacactcccactgatcgggaaactaaacaacggctatgatta |
37092065 |
T |
|
| Q |
219 |
tccatctggtgttgaggaaagtggggtacacaaacagcacaacaagctagatcctttg |
276 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37092064 |
tccatctagtgttgaggaaagtggggtacacaaacagcacaacaagctagatcctttg |
37092007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University