View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21136_low_7 (Length: 251)
Name: NF21136_low_7
Description: NF21136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21136_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 34650288 - 34650065
Alignment:
| Q |
18 |
catacagactcgacatgcaaacaaaagcatgaatagcagcaattctcacaaacccaagatgcttcagtttttcatgatcatttctctctacatccatctg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34650288 |
catacagactcgacatgcaaacaaaagcatgaatagcagcaattctcacaaacccaagatgcttcagtttttcatgatcatttctctctacatccatctg |
34650189 |
T |
 |
| Q |
118 |
cacaaattcaatgtataataaattattagatgagatctatattattattatagtaatatacgtgcat---tcatcatgcaatgtaaattaacctgtttgg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34650188 |
cacaaattcaatgtataataaattattagatgagatctatatta---ttatagtaatatacgtgcattcatcatcatgcaatgtaaattaacctgtttgg |
34650092 |
T |
 |
| Q |
215 |
tggtggtcattgcttcctttgtctgtg |
241 |
Q |
| |
|
|||||||||||| ||||||||| |||| |
|
|
| T |
34650091 |
tggtggtcattgtttcctttgtttgtg |
34650065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University