View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21137_high_4 (Length: 323)
Name: NF21137_high_4
Description: NF21137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21137_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 257 - 307
Target Start/End: Original strand, 11653440 - 11653490
Alignment:
| Q |
257 |
cattatggcgaggagtaataaagaaaaatgtattactctacatgtgctttg |
307 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
11653440 |
cattatggtgaggagtaataaagaaaaatgcattactctacatgtgctttg |
11653490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 31 - 74
Target Start/End: Original strand, 11652809 - 11652852
Alignment:
| Q |
31 |
taatgattgtgagttaaaggggaggtatgaattaaaaagtgatc |
74 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
11652809 |
taatgattgtgaggtaaaggggaggtatgaattaaaaagtgatc |
11652852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University