View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21138_low_10 (Length: 212)
Name: NF21138_low_10
Description: NF21138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21138_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 31322926 - 31322751
Alignment:
| Q |
19 |
tatactaatcaaagtagaaatagaccagttcttttataagcttcaaattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatattt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31322926 |
tatactaatcaaagtagaaatagaccagttcttttataagctttatattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatattt |
31322827 |
T |
 |
| Q |
119 |
caacatataagttttttcattttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatct |
194 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| || |||||||||||||| ||||||||||||| | |||||| |
|
|
| T |
31322826 |
caacatataagttgtttcattttgttactatgttattggtacaaagttttcactgtcgtttaccagtaactaatct |
31322751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 42563705 - 42563761
Alignment:
| Q |
138 |
ttttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatct |
194 |
Q |
| |
|
|||| ||| |||| || |||||||||||||| ||| ||||||| ||||||||||||| |
|
|
| T |
42563705 |
tttttttactatgatattgatacaaagtttttaccctcgtttaacagtgattaatct |
42563761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University