View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21138_low_10 (Length: 212)

Name: NF21138_low_10
Description: NF21138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21138_low_10
NF21138_low_10
[»] chr1 (2 HSPs)
chr1 (19-194)||(31322751-31322926)
chr1 (138-194)||(42563705-42563761)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 31322926 - 31322751
Alignment:
19 tatactaatcaaagtagaaatagaccagttcttttataagcttcaaattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatattt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31322926 tatactaatcaaagtagaaatagaccagttcttttataagctttatattcaaataattgtaaacggtttatactcttaagtagttatcgaagatatattt 31322827  T
119 caacatataagttttttcattttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatct 194  Q
    ||||||||||||| ||||||||||||| ||||||| || |||||||||||||| ||||||||||||| | ||||||    
31322826 caacatataagttgtttcattttgttactatgttattggtacaaagttttcactgtcgtttaccagtaactaatct 31322751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 194
Target Start/End: Original strand, 42563705 - 42563761
Alignment:
138 ttttgttattatgttactgatacaaagttttcaccgtcgtttaccagtgattaatct 194  Q
    |||| ||| |||| || |||||||||||||| ||| ||||||| |||||||||||||    
42563705 tttttttactatgatattgatacaaagtttttaccctcgtttaacagtgattaatct 42563761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University