View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21138_low_9 (Length: 238)
Name: NF21138_low_9
Description: NF21138
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21138_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 10 - 223
Target Start/End: Complemental strand, 4818995 - 4818782
Alignment:
| Q |
10 |
aagaaaatataccagtgatacaagggcgctgctggctactgacgtgtgtaaagggctactcggtaataaagcgcatttgagtatactagaacccaggtta |
109 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818995 |
aagaaaagataccagtgatacaagggcgctgctggctactgacgtgtgttaagggctactcggtaataaagcgcatttgagtatactagaacccaggtta |
4818896 |
T |
|
| Q |
110 |
caaaggatcaaatacaaagggatttgtggatgaataaatttagccaagtattttttcgcaaaccgagtattaacaactcactatgtatgttcacatacct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4818895 |
caaaggatcaaatacaaagggatttgtggatgaataaatttagccaagtattttttcgcaaaccgagtattaacaactcactatgtatgttcacatacct |
4818796 |
T |
|
| Q |
210 |
tgacaaatggaggt |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
4818795 |
tgacaaatggaggt |
4818782 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 112 - 165
Target Start/End: Complemental strand, 4845260 - 4845208
Alignment:
| Q |
112 |
aaggatcaaatacaaagggatttgtggatgaataaatttagccaagtatttttt |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
4845260 |
aaggatcaaatacaaagggatttgtggatgaatcaa-ttagccaagtatttttt |
4845208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University