View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2113_high_14 (Length: 269)
Name: NF2113_high_14
Description: NF2113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2113_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 29035285 - 29035031
Alignment:
| Q |
1 |
ttagaccccgtattgtagtgaagtcctccaaatttattggacgatatctttattttttagatggatcagacgatatcatttgatggtatattttttactc |
100 |
Q |
| |
|
||||||||||| |||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29035285 |
ttagaccccgtgttgttgtgaagtcctccaaatttattggacgatatctttgttttttagatggatcagacgatatcatttgatggtatattttttactc |
29035186 |
T |
 |
| Q |
101 |
attttatctatcgaaaaatatctttgaaaatgtattttgcctgttttgagcaacacataaggcctaaagagcaaccatcaacat-cattgatgtgc-aaa |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
29035185 |
attttatctatcgaaaaatatctttgaaaatgtattttgcctgttttgagcaacacataaggcctaaagagcaaccatcaacatccattgatgtgcaaaa |
29035086 |
T |
 |
| Q |
199 |
cacagattgtttgcacaaaataaatnnnnnnngatggacaggttcattgctattg |
253 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29035085 |
cacagattgtttgcacaaaataaataaaaaaagatggacaggttcattgctattg |
29035031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University