View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2113_high_17 (Length: 240)
Name: NF2113_high_17
Description: NF2113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2113_high_17 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 78 - 240
Target Start/End: Original strand, 5190034 - 5190196
Alignment:
| Q |
78 |
cctctttctatgcttaattaggtaaccagtttataaatatcatatcaccgacaccttttaagagtgattaagggtcaagattaactatagctcgaaattg |
177 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5190034 |
cctctttctatgcttaattaggtagccactttataaatatcatatcaccgacaccttttaagagtgattaagggtcaagattaactatagctagaaattg |
5190133 |
T |
|
| Q |
178 |
acagtggatttacaagcttatgtgactgtgagagtgaataaaacattgttgattcaattccct |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5190134 |
acagtggatttacaagcttatgtgactgtgagagtgaataaaacattgttgattcaattccct |
5190196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 5189950 - 5190009
Alignment:
| Q |
19 |
cacaaagctcctagttttttagggcattctctctctaatctttataatcttcttcaattc |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5189950 |
cacaaagctcctagttttttagggcattctctctctaatctttataatcttcttcaattc |
5190009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University