View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21140_high_10 (Length: 227)
Name: NF21140_high_10
Description: NF21140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21140_high_10 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 5 - 227
Target Start/End: Complemental strand, 12990636 - 12990414
Alignment:
| Q |
5 |
catgttcttgcattggatcccaacggatctatagtttggaaggtatgaagtatgaaccttcgtatatttgcaatttgttccctgatgaaggaagtaattt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12990636 |
catgttcttgcattggatcccaacggatctatagtttggaaggtatgaagtatgaaccttcgtatatttgcaatttgttccctgatgaaggaagtaattt |
12990537 |
T |
|
| Q |
105 |
taacgtgccttttttgtcaataaattttgttcagaaaacaactggtggtccaatatttgctggcccgtgcataccttctgttaatcctcacgaggtcaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12990536 |
taacgtgccttttttgtcaataaattttgttcagaaaacaactggtggtccaatatttgctggcccgtgcataccttctgttaatcctcacgaggtcaat |
12990437 |
T |
|
| Q |
205 |
tattctctacatggattttacaa |
227 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
12990436 |
tattctctacatggattttacaa |
12990414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University