View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21140_high_4 (Length: 390)
Name: NF21140_high_4
Description: NF21140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21140_high_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 43 - 375
Target Start/End: Original strand, 23879108 - 23879434
Alignment:
| Q |
43 |
agttcttgaagttagcaataccgtcaggggtcccgttcatgttgacttgtcattaagttcttcaaaggtaacgcctttgcaggattcagcagatgttcac |
142 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||||||||||||||||| |||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
23879108 |
agttcttgaagttagcaatactgtcaggggtaccattcatgttgacttgtcattacgttcttcaaatgtaatgcctttgcaggattcagcagatgttcac |
23879207 |
T |
 |
| Q |
143 |
agcaacgggtaagtacttatacttagtgatggatctatatacatacaagtagccgtattattatatttactcatttgcagttgctatctactcacatttt |
242 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |||||||| ||| | |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
23879208 |
agcaacgggtaagtactgatacttagtgatggatctat----atacaagttgccctgttattatatttactcatttgcagttgctatttactcacatttt |
23879303 |
T |
 |
| Q |
243 |
ttagcctctatgattattgctaatatctagaatgtttaatagtttttgagattttaacatgtgacttgacacaacagattctaagaattgaaaattttcc |
342 |
Q |
| |
|
| |||||| |||||||||||||||||||||||||||| || |||| |||||||||||| ||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
23879304 |
tgagcctcaatgattattgctaatatctagaatgtttctta--ttttaagattttaacatatgatttgacacaacagattctaagaattgaaaattttcc |
23879401 |
T |
 |
| Q |
343 |
tgaaatgtttttacaaattgaaaattgttctgt |
375 |
Q |
| |
|
|||||||||||| |||||| | |||||| |||| |
|
|
| T |
23879402 |
tgaaatgtttttgcaaatttataattgtactgt |
23879434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University