View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21140_low_11 (Length: 234)
Name: NF21140_low_11
Description: NF21140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21140_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 31337264 - 31337042
Alignment:
| Q |
1 |
actcatgagctagctgttaaaaatatatagatataatttgtgtatgtgtaacattat---atggtttgttatatattatttcaagaaaaattaattaagc |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
31337264 |
actcatgagctagctgttaaaaatatatagatataatttgtgtatgtgtaacattattatatggtttgttatatattattttaaaaaaaattaattaagc |
31337165 |
T |
 |
| Q |
98 |
attgagatgtccaagtataaattatgaccagaaacgataatgactctaaattatgtgtttctgttgcaaaactatatttatatttacttgttgtgtgctt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31337164 |
attgagatgtccaagtataaattatgaccagaaacgataatgactctaaattatgtgtttctgttgcaaaactctatttatatttacttgttgtgtgctt |
31337065 |
T |
 |
| Q |
198 |
gcataagaataagtataataatg |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
31337064 |
gcataagaataagtataataatg |
31337042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University