View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21140_low_8 (Length: 289)
Name: NF21140_low_8
Description: NF21140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21140_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 23 - 269
Target Start/End: Original strand, 2777788 - 2778034
Alignment:
| Q |
23 |
tccccattttgggtccgtcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctcaatt |
122 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777788 |
tccccattttgggtccttcctctccctcagtcttcttcaccaacgaccatggcatcccccgccaaactggataaagatcaggttttctctattctcaatt |
2777887 |
T |
|
| Q |
123 |
ttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcaatatcactttcactcctcctccgagtatttttcaattcaaatcgttttc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2777888 |
ttgcgttattaattacacttcaattctcttttatcttcttaatctcaatcgatatcactttcactcctcctccgagtatttttcaattcaaatcgttttc |
2777987 |
T |
|
| Q |
223 |
ttaccttcaaactgattctaactacttttttcgtattctgcacaggt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2777988 |
ttaccttcaaactgattctaactacttttttcgtattgtgcacaggt |
2778034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University