View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21142_low_13 (Length: 237)
Name: NF21142_low_13
Description: NF21142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21142_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 52026067 - 52025848
Alignment:
| Q |
1 |
ataaaaattgctacgccttttgtcaaaaataaatcaaagactgacgctcttctaagttttctattttatctcttatgctcaacatacttttgagccacta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52026067 |
ataaaaattgctacgccttttgtcaaaaataaatcaaagattgac---cttccaagttttctattttatctctaatgctcaacatacttttgagccacta |
52025971 |
T |
 |
| Q |
101 |
gtttgttatataaaaagtgcgaaagatatgtatttaaatgagctcctggaacccaaagtaatgacatctcctcaacacggccttgtatctctctcatgct |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52025970 |
gtttgttatataaaaagtgtgaaagatatgtatttaaatgagctcctcgaacccaaagtaatgacatcttctcaacacggccttgtatctctctcatgct |
52025871 |
T |
 |
| Q |
201 |
tcacaaaatggtctagttgaacc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
52025870 |
tcacaaaatggtctagttgaacc |
52025848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University