View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21143_low_10 (Length: 214)
Name: NF21143_low_10
Description: NF21143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21143_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 52 - 182
Target Start/End: Complemental strand, 46107878 - 46107748
Alignment:
| Q |
52 |
gtgctagggatggcagaacgaacaacaaaaggattccacgtgatgcagggcttttgggagagtgttcgggaatgagactgtcattgtccttacttctggc |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46107878 |
gtgctagggatggcagaacgaacaacaaaaggattccacgtgatgcagggcttttgggagagtgttcgggaatgagactgtcattgtccttacttctggc |
46107779 |
T |
|
| Q |
152 |
ggctgtgcctttaaatcaaaattgatgatgt |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
46107778 |
ggctgtgcctttaaatcaaaattgatgatgt |
46107748 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 72 - 163
Target Start/End: Original strand, 22539378 - 22539469
Alignment:
| Q |
72 |
aacaacaaaaggattccacgtgatgcagggcttttgggagagtgttcgggaatgagactgtcattgtccttacttctggcggctgtgccttt |
163 |
Q |
| |
|
||||||| | || ||||||||||||| || |||| | |||| || | ||||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
22539378 |
aacaacagatggtttccacgtgatgcgggcctttatgaagagagtacaagaatgggactgtcattgtccttacttgtggcggctgtgccttt |
22539469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University