View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21145_high_9 (Length: 239)
Name: NF21145_high_9
Description: NF21145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21145_high_9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 41358120 - 41358342
Alignment:
| Q |
18 |
caatcacagaagaaaaaatgttttgtaaaattccacacnnnnnnnnnnnnn-ggatgtgtaggttgtaacatgttttatctgcaaatatatatactttgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41358120 |
caatcacagaagaaaaaatgttttgtaaaattccacacttttttttttttttggatgtgtaggttgtaacatgttttatctgcaaatatatatactttgc |
41358219 |
T |
 |
| Q |
117 |
aaaggcacacattttttgtcttttacatgtgtacatcccaaagacgttttactattttaggggtggagaaaattactgccaccacaaacacttggaccgt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41358220 |
aaaggcacacattttttgtcttttacatgtgtacatcccaaagacgttttactattttaggggtggagaaaattactgccaccacaaacacttggaccgt |
41358319 |
T |
 |
| Q |
217 |
tgaacttggtcttgatggtgctt |
239 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41358320 |
tgaacttggtcttgatggtgctt |
41358342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University