View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21145_low_12 (Length: 221)

Name: NF21145_low_12
Description: NF21145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21145_low_12
NF21145_low_12
[»] chr8 (1 HSPs)
chr8 (21-201)||(18355298-18355478)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 21 - 201
Target Start/End: Complemental strand, 18355478 - 18355298
Alignment:
21 aatgagaaaccttgttggtaatgggcgattatatgaatgaatgaatgagaagcaatgtgcatgcaaggaaatggaaaagagggttgttgtgtgaatccaa 120  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18355478 aatgagaaaccttgttggtaatgggggattatgtgaatgaatgaatgagaagcaatgtgcatgcaaggaaatggaaaagagggttgttgtgtgaatccaa 18355379  T
121 aagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcggcgctctctctcactctcttcttgttgttgctt 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18355378 aagaagaagcgcttttcagaataatcgcttttcaggtttcgcttttcggcgctctctctcactctcttcttgttgttgctt 18355298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University