View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21145_low_5 (Length: 409)
Name: NF21145_low_5
Description: NF21145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21145_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 388; Significance: 0; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 388; E-Value: 0
Query Start/End: Original strand, 1 - 396
Target Start/End: Complemental strand, 47810795 - 47810400
Alignment:
| Q |
1 |
gattgagaacgagttgttgtaactcgcggttgaagccttgtgagactctgtcagagaaccgagttaaaagttgaagcaactcgtcttcgttttcattgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47810795 |
gattgagaacgagttgttgtaactcgcggttgaagccttgtgagactctgtcagagaaccgagttaaaagttgaagcaactcgtcttcgttttcattgtt |
47810696 |
T |
 |
| Q |
101 |
gttgccggagacgagacaggagagggtggtgacagtttcacggtcgatccatgattgaagttcggattcgattgcggcggaggttttggtgatggagtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47810695 |
gttgccggagacgagacaggagagggtggtgacagtttcacggtcgatccatgattgaagttcggattcgattgcggcggaggttttggtgatggagtga |
47810596 |
T |
 |
| Q |
201 |
gatgagatgggacgagttatgaacgatttgagactcggttttgagctttggagcgagctgactagggatttgaggtgggtgaggtggtgagagatgtttg |
300 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47810595 |
gatgagaggggacgagttatgaacgatttgagactcggttttgagctttggagcgagttgactagggatttgaggtgggtgaggtggtgagagatgtttg |
47810496 |
T |
 |
| Q |
301 |
aattagttggaagaattgtgtggagttggaaaagtgcttttatggaagatgaattggaatctgagaagtgattatggtgattttggatgttttgag |
396 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47810495 |
aattagttggaagaattgtgtggagttggaaaagtgcttttatggaagatgaattggaatctgagaagtgattatggtgattttggatgttttgag |
47810400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 1 - 370
Target Start/End: Original strand, 3928335 - 3928704
Alignment:
| Q |
1 |
gattgagaacgagttgttgtaactcgcggttgaagccttgtgagactctgtcagagaaccgagttaaaagttgaagcaactcgtcttcgttttcattgtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3928335 |
gattgagaacgagttgttgtaactcgcggttgaagccttgtgagactctgtcagataaccgagttaaaagttgaagcaactcgtcttcgttttcattgtt |
3928434 |
T |
 |
| Q |
101 |
gttgccggagacgagacaggagagggtggtgacagtttcacggtcgatccatgattgaagttcggattcgattgcggcggaggttttggtgatggagtga |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3928435 |
attgtcggagacgagacaggagagggtggtgacagtttcactgtcgatccatgattgaagttcggattcgattgcggcggaggttttggtgatggagtga |
3928534 |
T |
 |
| Q |
201 |
gatgagatgggacgagttatgaacgatttgagactcggttttgagctttggagcgagctgactagggatttgaggtgggtgaggtggtgagagatgtttg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3928535 |
gatgagatgggacgagttatgaacgatttgagactcggttttgagctttggagcgagttgactagggatttgaggtgggtgaggtggtgagagatgtttg |
3928634 |
T |
 |
| Q |
301 |
aattagttggaagaattgtgtggagttggaaaagtgcttttatggaagatgaattggaatctgagaagtg |
370 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3928635 |
aattagttggaagaattgtgtggagttggaaaagtgcttttatggaagatgaattggaatctgagaagtg |
3928704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University