View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21145_low_8 (Length: 248)

Name: NF21145_low_8
Description: NF21145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21145_low_8
NF21145_low_8
[»] chr5 (1 HSPs)
chr5 (8-120)||(27428189-27428301)


Alignment Details
Target: chr5 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 27428301 - 27428189
Alignment:
8 gagatgaaacaattaatttagagcaatgagaatgattatttaagtgatgattcattttcttatatacataattgaactctttttacttcttatttctcac 107  Q
    ||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||    
27428301 gagatgaaacaattaatttagagcaatcagaatgattgtttaagtgatgattcattttcttatatacatagttgaactctttttacttcttagttctcac 27428202  T
108 aatccttgcgttc 120  Q
    |||||||||||||    
27428201 aatccttgcgttc 27428189  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University