View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21147_low_4 (Length: 390)
Name: NF21147_low_4
Description: NF21147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21147_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 142; Significance: 2e-74; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 183 - 364
Target Start/End: Original strand, 13074798 - 13074973
Alignment:
| Q |
183 |
ttggtttggttttctctacgatggtttctctagtttgttgctcctctccatgcatattggttatgctataaattggtttggttatttttcagggttaatt |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
13074798 |
ttggtttggttttctctacgatggtttctctac---gttgctcctctccatgcatattggttatgctataaattggtttggttatttttcaaggttaatt |
13074894 |
T |
 |
| Q |
283 |
ctaacaacgttaaacttaataggctttcatttgagtggtattattattagaataatgtgtttttagtttatgttaagtatgc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13074895 |
ctaacaacgttaaacttaataggctttcacttgagtgg---tattattagaataatgtgtttttagtttatgttaagtatgc |
13074973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 62 - 184
Target Start/End: Original strand, 13074614 - 13074736
Alignment:
| Q |
62 |
accaaaagcatattttaaccttaaatatttatatgaaatcctatgttacttctttaccttagttcttctctttcattgacctgatcttcttgttgattct |
161 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13074614 |
accaaaaatatattttagccttaaatatttatatgaaatcctatgttacttctttaccttggttcttctctttcattgacctgatcttcttgttgattct |
13074713 |
T |
 |
| Q |
162 |
tctatttgattgatcatgttttt |
184 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13074714 |
tctatttgattgatcatgttttt |
13074736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University