View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21147_low_9 (Length: 249)
Name: NF21147_low_9
Description: NF21147
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21147_low_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 2323988 - 2323757
Alignment:
| Q |
1 |
atgtgtataggtgaaaattattcaaagttgtaaaatagtgaatccaaacatccattttttatgcttttaattttcgctcgagctagaaaaatttcttaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2323988 |
atgtgtataggtgaaaattattcaaagttgtaaaatagtgaatccaaacattcattttttatgcttttaattttcgctcgagctagaaaaatttcttaaa |
2323889 |
T |
 |
| Q |
101 |
gatggcgagcgaaatacaaccaattgaaccaaattgtatttgttaatagaatccactagctatagcataaagggttttcatgtccaattgcat-gttttt |
199 |
Q |
| |
|
| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2323888 |
ggtggcgagcgaaatacaacca----------attgtatttgttaatagaatccactagctatagcataaagggttttcatgtccaattgcatagttttt |
2323799 |
T |
 |
| Q |
200 |
taatccatcttaatcaagtctctttgtttaaagcagtattat |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2323798 |
taatccatcttaatcaagtctctttgtttaaagcagtattat |
2323757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 118 - 155
Target Start/End: Complemental strand, 2344895 - 2344858
Alignment:
| Q |
118 |
aaccaattgaaccaaattgtatttgttaatagaatcca |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2344895 |
aaccaattgaaccaaattgtatttgttaatagaatcca |
2344858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University