View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21148_high_5 (Length: 306)
Name: NF21148_high_5
Description: NF21148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21148_high_5 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 279; Significance: 1e-156; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 16 - 306
Target Start/End: Complemental strand, 34609442 - 34609152
Alignment:
| Q |
16 |
attaccaattatttcatcagcggtggtgagcctttcccttggggcgctttccagcaagagtgtgcttcggtctgagattaactataaccctatcagcttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609442 |
attaccaattatttcatcagcggtggtgagcttttcccttggggcgctttccagcaagagtgtgcttcggtctgagattaactataaccctatcagcttc |
34609343 |
T |
 |
| Q |
116 |
tccgcgacgagcagctttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcaca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34609342 |
tccgcgacgagcagctttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcaca |
34609243 |
T |
 |
| Q |
216 |
acaacgggaagtggttgctgaaccgatctggaaaaacgtgacactgatctactcaacctctgcttcgtcatcttgctaggcttgtcaccat |
306 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
34609242 |
acaacgtgaagtggttgctgaaccgatctggaaaaacgtgacactgatctactcaacctctgcttcttcatcttgctaggcttgtcaccat |
34609152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 47 - 208
Target Start/End: Complemental strand, 32397716 - 32397555
Alignment:
| Q |
47 |
ctttcccttggggcgctttccagcaagagtgtgcttcggtctgagattaactataaccctatcagcttctccgcgacgagcagctttgtttctcttctta |
146 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||| | || ||||| || || |||||||||||||| || ||| |||||||||||||| |
|
|
| T |
32397716 |
ctttccgttggagcgctttccagcatacaagtgcttcggtttaaggttaacgatgactctatcagcttctccccgcttggcattcttgtttctcttcttg |
32397617 |
T |
 |
| Q |
147 |
gaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctcc |
208 |
Q |
| |
|
|| | | ||| |||||||| ||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
32397616 |
gatgatcccttcgcaagtttgattgctttgatcttttgagcagaatccctaaggccttctcc |
32397555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 132 - 217
Target Start/End: Complemental strand, 6130985 - 6130900
Alignment:
| Q |
132 |
ttgtttctcttcttagaagctttctttgcaagttttattgccttcatcttttgagcagaatccctaaaaccttctccaggcacaac |
217 |
Q |
| |
|
|||||||||||||| |||| | ||| |||||||| ||||| || |||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
6130985 |
ttgtttctcttcttggaagatcccttcgcaagtttaattgctttgatcttttgagcagaatccctaaggccttctccaggaacaac |
6130900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University