View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21148_low_12 (Length: 214)
Name: NF21148_low_12
Description: NF21148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21148_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 49 - 198
Target Start/End: Original strand, 28296087 - 28296236
Alignment:
| Q |
49 |
gaaggaccatacagtttagaaattgatttcaaaatttgttcaaaattttgtatgaacaacataggggctaggaatatagttcaagtcaaatttgactcac |
148 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28296087 |
gaaggactatacagtttagaaattgatttcaaaatttgttcaaaattttgtatgaacaacataggggctgggaatatagttcaagtcaaatttgactcac |
28296186 |
T |
|
| Q |
149 |
caagtgtggccatgacagcagcaaaaacaattatgcctactggctgcacc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28296187 |
caagtgtggccatgacagcagcaaaaacaattatgcctactggctgcacc |
28296236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 198
Target Start/End: Complemental strand, 36991368 - 36991292
Alignment:
| Q |
121 |
aatatagttcaagtcaaatttgactcaccaagtgtggccatgacagcagcaaaaacaattatgcctactggctgcacc |
198 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||||||||| |||||| | ||||||| |||||| ||||||||| |
|
|
| T |
36991368 |
aatatagtttaagtcaa-tatgactcaccaagtgtggccatcacagcaaaagcgacaattaggcctaccggctgcacc |
36991292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 198
Target Start/End: Complemental strand, 37016808 - 37016732
Alignment:
| Q |
121 |
aatatagttcaagtcaaatttgactcaccaagtgtggccatgacagcagcaaaaacaattatgcctactggctgcacc |
198 |
Q |
| |
|
||||||||| ||||||| | ||||||||||||||||||||| |||||| | ||||||| |||||| ||||||||| |
|
|
| T |
37016808 |
aatatagtttaagtcaa-tatgactcaccaagtgtggccatcacagcaaaagcgacaattaggcctaccggctgcacc |
37016732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University