View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21148_low_5 (Length: 322)
Name: NF21148_low_5
Description: NF21148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21148_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 18 - 315
Target Start/End: Original strand, 32731995 - 32732294
Alignment:
| Q |
18 |
agattttggatagcattttcattcaatgaatggttgtaattcatgctttgtttttgtgcttgtagtaagtccaatcatgaatgtgatcttactctcactc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32731995 |
agattttggatagcattttcattcaatgaatggttgtaattcatgctttgtttttgtgcttgtagtaagtccaatcatgaatgtgatcttactctcactc |
32732094 |
T |
 |
| Q |
118 |
actcannnnnnnc-ctattgtaatatgatggttgggcatgaatctttatggcttagattggttttctcgttacatcagtggacaataaaattctgtcaaa |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
32732095 |
actcattttttttgctattgtaatatgatggttgggcatgaatctttatggcttagattggttttctagttacatcagtggacaataaaattctgtcaaa |
32732194 |
T |
 |
| Q |
217 |
ttatatatttttcctttttatagtttaaacatatataag-atcattgtttttagacttggtatcctccacaaccaactatgaagactaatcatcaggtct |
315 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32732195 |
ttatataattttcttttttatagtttaaacatatataagaatcattgtttttagacttagtatcctccacaaccaactatgaagactaatcatcaggtct |
32732294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University