View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21149_high_15 (Length: 322)
Name: NF21149_high_15
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21149_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 80 - 304
Target Start/End: Original strand, 44825292 - 44825516
Alignment:
| Q |
80 |
tagtatatgctttgggaagaattttgtttgatattggataattgcatcccaagcattaaatcttacatattctttaactaaatgttaattaaggagtagg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44825292 |
tagtatatgctttgggaagaattttgtttgatattggataattgcatcccaagcattaaagcttacatattctttaactaaatgttaattaaggagtagg |
44825391 |
T |
 |
| Q |
180 |
ttagacagatcagcggtgattggtgaacacaatcacctttaacaaatacaaacccgaggcatgtaattggctttgggcctgtgacacttctttccttgga |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44825392 |
ttagacagatcagcggtgattggtgaacacaatcacctttaacaaatacaaacccgaggcatgtaattggctttgggcctgtgacacttctttccttgga |
44825491 |
T |
 |
| Q |
280 |
cctcgattcccacaatattcatatc |
304 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44825492 |
cctcgattcccacaatattcatatc |
44825516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 81
Target Start/End: Original strand, 44825181 - 44825261
Alignment:
| Q |
1 |
agagatttgactgtttcttattagagaagcaatctaaagattttcttctaggagaattgacttgctttcctgaaggtcata |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44825181 |
agagatttgactgtttcttattagagaagcaatctaaagattttcttctaggagaattgacttgctttcctgaaggtcata |
44825261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University