View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21149_low_20 (Length: 295)
Name: NF21149_low_20
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21149_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 280
Target Start/End: Complemental strand, 46752341 - 46752061
Alignment:
| Q |
1 |
aactataacagagaggagtatcgagtgttcattattattggagcactgaaaatttgttcaaataaggcaagcatgggggccataggtttagcaaggctct |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752341 |
aactataatagagaggagtatcgagtgttcattattattggagcactgaaaatttgttcaaataaggcaagcatgggggccataggtttagcaaggctct |
46752242 |
T |
 |
| Q |
101 |
ccaccactgactttggattttagatgtctttttctaaagaaatcttatttcatgagattagtctccatagttaaatgtgcagattaattaagttataata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46752241 |
ccaccactgactttggattttagatgtcttgttataaagaaatcttgtttcatgagattagtctccatagttaaatgtgcagattaattaagttataata |
46752142 |
T |
 |
| Q |
201 |
atgatttcggttaaaaattgaagtcgtgactagatgctgcttaacacat-cccatcccacatctaataatctgtcaatact |
280 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
46752141 |
atcatttcggttaaaaattgaagtcgtgactagatgctgcttaacacatacacatcccacatctaataatctgtcaatact |
46752061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University