View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21149_low_21 (Length: 273)
Name: NF21149_low_21
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21149_low_21 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 258
Target Start/End: Original strand, 7945745 - 7945992
Alignment:
| Q |
11 |
cacagatataggtaatgataaggaaccattggattggcatacaaggatgaaaattgccaacggatcagcaagaggacttgaatatctgcataactacgca |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
7945745 |
cacagatataggtaatgataaggaaccattggattggcatacaaggatgaaaattgccaacggagcagcaagaggacttgaatatctgcataactacgca |
7945844 |
T |
 |
| Q |
111 |
gatccaccagtgatttttcgtgatttaaaatcgtctaatatactattggatgaaaatttcaatccaaagctttctgattttggtcttgccaagattgccc |
210 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7945845 |
gatccaccggtgatttttcgtgatttaaaatcgtctaatatactattggatgaaaatttcaatccaaagctttctgattttggtcttgccaagattgccc |
7945944 |
T |
 |
| Q |
211 |
ctagagagggtgagtttgtgcccaaaactagagttatggggacttatg |
258 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7945945 |
caagagagggtgagtttgtgcccaaaactagagttatggggacttatg |
7945992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 114 - 199
Target Start/End: Complemental strand, 40225330 - 40225245
Alignment:
| Q |
114 |
ccaccagtgatttttcgtgatttaaaatcgtctaatatactattggatgaaaatttcaatccaaagctttctgattttggtcttgc |
199 |
Q |
| |
|
||||| ||||| | ||||||||| ||| | || || ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |
|
|
| T |
40225330 |
ccaccggtgatatatcgtgatttcaaagcatcaaacatactcttggatgaaaatttcaatccaaaactctctgattttggacttgc |
40225245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 199
Target Start/End: Complemental strand, 19993362 - 19993313
Alignment:
| Q |
150 |
atactattggatgaaaatttcaatccaaagctttctgattttggtcttgc |
199 |
Q |
| |
|
|||||||| |||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
19993362 |
atactattagatgaaaactacaatccaaagctttctgattttggacttgc |
19993313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 10979528 - 10979488
Alignment:
| Q |
159 |
gatgaaaatttcaatccaaagctttctgattttggtcttgc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
10979528 |
gatgaaaatttcaatccaaaagtttctgattttggacttgc |
10979488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 11007932 - 11007892
Alignment:
| Q |
159 |
gatgaaaatttcaatccaaagctttctgattttggtcttgc |
199 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
11007932 |
gatgaaaatttcaatccaaaagtttctgattttggacttgc |
11007892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University