View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21149_low_26 (Length: 240)
Name: NF21149_low_26
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21149_low_26 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 61 - 240
Target Start/End: Original strand, 51851592 - 51851768
Alignment:
| Q |
61 |
gtatatcagaaattggtactttgtgatagaagatcttatagcttcgaaataaacaggctatacaagcaaattgggagccaagatactcaagatgctgcca |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51851592 |
gtatatcagaaattggtactttgtgatagaagatct---agtttcgaaataaacaggctatacaagcaaattgggagccaagatactcaagatgctgcca |
51851688 |
T |
|
| Q |
161 |
caagatcccatggcagcaatatgcaaaagtgggagctgctcttcgccattttagttacactgttgtagcactacatggtt |
240 |
Q |
| |
|
|| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
51851689 |
caggatcccatggcagcaatatgcaaaagtaggagctgctcttcgccattttagttacaccgttgtagcactacatggtt |
51851768 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 88 - 238
Target Start/End: Original strand, 51821857 - 51822007
Alignment:
| Q |
88 |
agaagatcttatagcttcgaaataaacaggctatacaagcaaattgggagccaagatactcaagatgctgccacaagatcccatggcagcaatatgcaaa |
187 |
Q |
| |
|
||||||||||| || | ||| ||||||||| | ||||||| |||||||||||||||||||| ||||||||| | ||||||||||||||||||||||| |
|
|
| T |
51821857 |
agaagatcttacagtgttgaattaaacaggcattgcaagcaagttgggagccaagatactcaaaatgctgccagagaatcccatggcagcaatatgcaaa |
51821956 |
T |
|
| Q |
188 |
agtgggagctgctcttcgccattttagttacactgttgtagcactacatgg |
238 |
Q |
| |
|
||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51821957 |
agtaggagcttctcttcgccattttagttacactgttgtagcactacatgg |
51822007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 112 - 238
Target Start/End: Original strand, 51861740 - 51861866
Alignment:
| Q |
112 |
aacaggctatacaagcaaattgggagccaagatactcaagatgctgccacaagatcccatggcagcaatatgcaaaagtgggagctgctcttcgccattt |
211 |
Q |
| |
|
||||||| || ||||| |||||||||||||||||||||||| ||||||| | |||||||||||| |||||||||||||| ||| || ||||||| ||||| |
|
|
| T |
51861740 |
aacaggcaatgcaagctaattgggagccaagatactcaagaagctgccataggatcccatggcaacaatatgcaaaagtcggaacttctcttcgtcattt |
51861839 |
T |
|
| Q |
212 |
tagttacactgttgtagcactacatgg |
238 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
51861840 |
tagttacactgttgtcgcactacatgg |
51861866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University