View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21149_low_32 (Length: 208)
Name: NF21149_low_32
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21149_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 13 - 162
Target Start/End: Complemental strand, 7092208 - 7092061
Alignment:
| Q |
13 |
aagaaaatctgacctcttacctaaatccaggaggaagaagaaatttcgagaatattatatcctaccatccttttcaatacctaactttttaatatccaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
7092208 |
aagaaaatctgacctcttacctaaatccaggaggaagaagaaatttcgagaatattat--cctaccatccttttcaacacctaactttttcatatccaaa |
7092111 |
T |
|
| Q |
113 |
cattttagtagtcaaatctttactttagaccatataaaaggaaggaggat |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7092110 |
cattttagtagtcaaatctttactttagaccatataaaaggaaggaggat |
7092061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University