View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21149_low_33 (Length: 202)
Name: NF21149_low_33
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21149_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 16 - 181
Target Start/End: Original strand, 8361552 - 8361717
Alignment:
| Q |
16 |
gagagggcaacgagatcttgcaaggaaagtcctctttgagagaagctttgttgtaattgggagatgttgaaagtgggagctggcaattgtctcgtttcag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8361552 |
gagagggcaacgagatcttgcaaggaaagtcctctttgagagaagctttgttgtaattgggagatgttgaaagtgggagctggcaattgtctcgtttcag |
8361651 |
T |
|
| Q |
116 |
tagcctttgagattataccatcctttcttccttttggtacttcccaatttggccctccggactaat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8361652 |
tagcctttgagattataccatcctttcttccttttggtacttcccaatttggccctccggactaat |
8361717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University