View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21149_low_9 (Length: 481)

Name: NF21149_low_9
Description: NF21149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21149_low_9
NF21149_low_9
[»] chr8 (2 HSPs)
chr8 (144-465)||(42209440-42209763)
chr8 (11-69)||(42209835-42209893)
[»] chr2 (1 HSPs)
chr2 (427-462)||(33171681-33171716)
[»] chr5 (1 HSPs)
chr5 (427-465)||(35244862-35244900)


Alignment Details
Target: chr8 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 144 - 465
Target Start/End: Complemental strand, 42209763 - 42209440
Alignment:
144 gatgttagtagcaccgttaacattacttaatttgggttctgcagcaacatgtgtagatggtaatttccagttcacggggaatgtcaaaatgtcccaccag 243  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42209763 gatgttagtagccccgttaacattacttaatttgggttctgcagcaacatgtgtagatggtaatttccagttcacggggaatgtcaaaatgtcccaccag 42209664  T
244 gtctactctctatctgtttgcatttactcaagatgccatttcatatcattgctttctgttgtggattagacgtcataaggcaaatattaattctttctta 343  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42209663 gtctactctctatctgtttgcatttactcaagatgccatttcatatcattgctttctgttgtggattagacgtcataaggcaaatattaattctttctta 42209564  T
344 gaggattgattgagannnnnnnaaaagtattaaacaaaaagttaagacctattaagtgactttctagaatggtgctagca--acactctttgattggtta 441  Q
    |||||||||||||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||    
42209563 gaggattgattgagatttttttaaaagtattaaacaaaaagttaagacctattaagtgactttctagaatggtgctagcaacacactctttgattggtta 42209464  T
442 aatttcacatggttcccaccatat 465  Q
    || |||||||||||||||||||||    
42209463 aaattcacatggttcccaccatat 42209440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 11 - 69
Target Start/End: Complemental strand, 42209893 - 42209835
Alignment:
11 cagagactatgaaaccccctgatattagcactacatctaccaaaggcaagtcatgacgg 69  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42209893 cagagactatgaaaccccctgatattagcactacatctaccaaaggcaagtcatgacgg 42209835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 427 - 462
Target Start/End: Complemental strand, 33171716 - 33171681
Alignment:
427 ctctttgattggttaaatttcacatggttcccacca 462  Q
    ||||||||||||||||||||||||||| ||||||||    
33171716 ctctttgattggttaaatttcacatgggtcccacca 33171681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 427 - 465
Target Start/End: Original strand, 35244862 - 35244900
Alignment:
427 ctctttgattggttaaatttcacatggttcccaccatat 465  Q
    ||||||||||||||||| ||||||||| |||||||||||    
35244862 ctctttgattggttaaaattcacatggatcccaccatat 35244900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University