View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2114_high_17 (Length: 310)
Name: NF2114_high_17
Description: NF2114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2114_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 2335740 - 2335484
Alignment:
| Q |
1 |
gttttgcctgatgatgctaaggttgatgaaattaaggctgagttgaaggatggtgtcctaattgttactattcctaggagtgaaaagcctaaaaaagatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
2335740 |
gttttgcctgatgatgctaaggttgatgaaattaaggctgagttgaaggatggtgtcctaattgttactattcctagaagtgaaaagcctagaaaagatg |
2335641 |
T |
 |
| Q |
101 |
ttaagcaagtgaatgtagagtga---taggattgattctataagagtgtggtgaacttgtaaacttgagatggatttgtgaagtttgtgacttgtgaacc |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2335640 |
ttaagcaagtgaatgtagagtgatattaggattgattctataagagtgtggtgaagttgtgaactt-agatggatttgtgaagtttgtgacttgtgaacc |
2335542 |
T |
 |
| Q |
198 |
tatgacattaataacttttgtgtgtgtgtatctttgaatttcatagtgaatcaaataa |
255 |
Q |
| |
|
|||| ||||||| |||| ||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
2335541 |
tatggcattaatgacttgtgtgtatgtgtatctttgaatttcatagagaatcaaataa |
2335484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University