View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2114_high_24 (Length: 248)

Name: NF2114_high_24
Description: NF2114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2114_high_24
NF2114_high_24
[»] chr3 (1 HSPs)
chr3 (10-229)||(52163907-52164126)
[»] chr1 (2 HSPs)
chr1 (20-229)||(6635012-6635221)
chr1 (121-162)||(40207480-40207521)
[»] chr8 (1 HSPs)
chr8 (34-227)||(33346586-33346779)
[»] chr5 (2 HSPs)
chr5 (34-229)||(7266316-7266511)
chr5 (21-227)||(15964247-15964453)
[»] chr6 (1 HSPs)
chr6 (127-227)||(2498508-2498608)
[»] chr4 (1 HSPs)
chr4 (127-227)||(27101096-27101196)


Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 10 - 229
Target Start/End: Complemental strand, 52164126 - 52163907
Alignment:
10 gattatactgcaaagattgaggattggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccggga 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52164126 gattatactgcaaagattgaggattggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccggga 52164027  T
110 atattgctccggtggatcataggtggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgtt 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52164026 atattgctccggtggatcataggtggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgtt 52163927  T
210 gcattggagtgggaaaggta 229  Q
    ||||||||||||||||||||    
52163926 gcattggagtgggaaaggta 52163907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 20 - 229
Target Start/End: Complemental strand, 6635221 - 6635012
Alignment:
20 caaagattgaggattggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccgggaatattgctcc 119  Q
    ||||||||||||| |||||||| || || ||||||||||| ||||||||| | ||||| ||||| || ||||||||||||||||| ||| | |||| |||    
6635221 caaagattgaggaatggatggaattacaaaagaggatgagaatctatgaacttggttcattgccaccttttttgcttgtttttgcaggggaaattgttcc 6635122  T
120 ggtggatcataggtggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgttgcattggagt 219  Q
     ||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||| ||||| |||||||| ||||||||||||    
6635121 agtggatcatagatggaatcaacatggtcttggtggtgataattttcgaggtctttgtagagatcttcatcctggtccagtgagtttattgcattggagt 6635022  T
220 gggaaaggta 229  Q
    || |||||||    
6635021 ggaaaaggta 6635012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 162
Target Start/End: Original strand, 40207480 - 40207521
Alignment:
121 gtggatcataggtggaatcaacatggacttggtggtgataat 162  Q
    ||||||||||||||||||||||| |||||||| |||||||||    
40207480 gtggatcataggtggaatcaacacggacttggaggtgataat 40207521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 34 - 227
Target Start/End: Original strand, 33346586 - 33346779
Alignment:
34 tggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccgggaatattgctccggtggatcataggt 133  Q
    |||||||||||||||||||| ||||| ||||||||  | ||||||||||||||||||||| | |||||||||||||  ||| | |||||||||||  |||    
33346586 tggatggagttgcagaagagaatgagaatctatgagcttggttcgttgccgccgtttttgttggtttttgccgggaggattacgccggtggatcaccggt 33346685  T
134 ggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgttgcattggagtgggaaagg 227  Q
    ||||||| ||||| || || ||||||||||||||||| |||||| |  || | ||||| || || ||||||||||||||||||||||| |||||    
33346686 ggaatcagcatgggctcggcggtgataattttcgtgggctttgtcgggatttgcatccaggcccggtgagtttgttgcattggagtggaaaagg 33346779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 34 - 229
Target Start/End: Complemental strand, 7266511 - 7266316
Alignment:
34 tggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccgggaatattgctccggtggatcataggt 133  Q
    ||||||||| | |||||||| ||||||||||||||  | ||||| |||||||||||| |||||||||| || || || || | |||||| |||||| |||    
7266511 tggatggagcttcagaagagaatgaggatctatgagcttggttcattgccgccgtttctgcttgttttcgcaggtaaaatagttccggttgatcatcggt 7266412  T
134 ggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgttgcattggagtgggaaaggta 229  Q
    ||||||||||||| ||||| ||||||||||| | ||| |||||| |  || | ||||| || || ||||||||  | |||||||||||||| ||||    
7266411 ggaatcaacatgggcttggcggtgataatttccatgggctttgtcgggatttgcatccgggcccggtgagtttacttcattggagtgggaagggta 7266316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 21 - 227
Target Start/End: Complemental strand, 15964453 - 15964247
Alignment:
21 aaagattgaggattggatggagttgcagaagaggatgaggatctatgaattgggttcgttgccgccgtttttgcttgtttttgccgggaatattgctccg 120  Q
    |||||||||  | ||||||||||| || |||| ||  || ||||||||  | ||||| ||||| || ||||| ||||||||||| || ||| |||   |     
15964453 aaagattgaaaactggatggagttacaaaagaagagaagaatctatgagctaggttcattgccaccttttttacttgtttttgcaggaaatgttgaagct 15964354  T
121 gtggatcataggtggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgttgcattggagtg 220  Q
     | |||||||| ||||||||||||||||||||||||||||||||   |||| ||||||||  | | ||||| |||||||| ||||| |||||||||||||    
15964353 attgatcatagatggaatcaacatggacttggtggtgataatttgaatggtgtttgtagatctttgcatcctggtcctgttagtttattgcattggagtg 15964254  T
221 ggaaagg 227  Q
    | |||||    
15964253 gaaaagg 15964247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 227
Target Start/End: Complemental strand, 2498608 - 2498508
Alignment:
127 cataggtggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgttgcattggagtgggaaag 226  Q
    ||||| |||||||||||||| ||||||||||||||| ||  || |  |||||||| | | ||||| ||||| || |||||||| ||||||||||| ||||    
2498608 catagatggaatcaacatggtcttggtggtgataatgttgttgatagttgtagaagtttgcatcctggtccagttagtttgttacattggagtggtaaag 2498509  T
227 g 227  Q
    |    
2498508 g 2498508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 227
Target Start/End: Complemental strand, 27101196 - 27101096
Alignment:
127 cataggtggaatcaacatggacttggtggtgataattttcgtggtctttgtagaaatcttcatcccggtcctgtgagtttgttgcattggagtgggaaag 226  Q
    ||||| |||||||||||||| ||||||||||||||| ||  || |  |||||||| | | ||||| ||||| || |||||||| ||||||||||| ||||    
27101196 catagatggaatcaacatggtcttggtggtgataatgttgttgatagttgtagaagtttgcatcctggtccagttagtttgttacattggagtggtaaag 27101097  T
227 g 227  Q
    |    
27101096 g 27101096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University