View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2114_low_12 (Length: 359)
Name: NF2114_low_12
Description: NF2114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2114_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 109; Significance: 9e-55; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 109; E-Value: 9e-55
Query Start/End: Original strand, 237 - 349
Target Start/End: Complemental strand, 9636803 - 9636691
Alignment:
| Q |
237 |
aagctcgactttttcttctttattatcagtaggaaatagcaagcctagattcatggttccttttatgtatttgagaatcctatcttagatgcagtaagat |
336 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9636803 |
aagctcggctttttcttctttattatcagtaggaaatagcaagcctagattcatggttccttttatgtatttgagaatcctatcttagatgcagtaagat |
9636704 |
T |
|
| Q |
337 |
gccacttcctatg |
349 |
Q |
| |
|
||||||||||||| |
|
|
| T |
9636703 |
gccacttcctatg |
9636691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University