View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2114_low_5 (Length: 487)
Name: NF2114_low_5
Description: NF2114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2114_low_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 377 - 448
Target Start/End: Complemental strand, 13083046 - 13082975
Alignment:
| Q |
377 |
tgattacatcaagcctatatatttttaacatctctaataataacaaagtcttaagaatgtggtatgtcaaat |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13083046 |
tgattacatcaagcctatatatttttaacatctctaataataacaaagtcttaagaatgtggtatgtcaaat |
13082975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University