View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21151_high_10 (Length: 341)
Name: NF21151_high_10
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21151_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 6e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 6e-96
Query Start/End: Original strand, 81 - 324
Target Start/End: Original strand, 49040886 - 49041124
Alignment:
| Q |
81 |
attaatgatgtactaactcacaagtcacaagtgctaataaaataatacacctttttt--ctcgttacattgaattaataacaacaagaaaaggtaacaat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || | |
|
|
| T |
49040886 |
attaatgatgtactaactcacaagtcacaagtgctaataaaataatacaccttttttttctcgttacattgaattaataacaacaagaaaa--tagc--- |
49040980 |
T |
 |
| Q |
179 |
cttgctttacaaatttt-aagaagcaacagaaacagggacactaacgggatacttatgaacagagtcatcccaggggttgccccgccaatccccaacgac |
277 |
Q |
| |
|
| |||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49040981 |
---gttttagaaatttttaagaagcaacagaaacagggacactaacgggatacttatgaacagagtcatcccaggggttgccccgccaatccccaacgac |
49041077 |
T |
 |
| Q |
278 |
gggcaagtcgcgcacggccttccacacggcgctgttacacttaaaac |
324 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49041078 |
gggcaagtcacgcacggccttccacacggcgctgttacacttaaaac |
49041124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University