View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21151_high_11 (Length: 341)
Name: NF21151_high_11
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21151_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 115 - 325
Target Start/End: Original strand, 39678461 - 39678671
Alignment:
| Q |
115 |
caaatagggatttgattcgatttctgcagcacaccgtggttatctgaaggtcctctatacaccttgagaataaatcagttcatgatcaaaaaagcaaacc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678461 |
caaatagggatttgattcgatttctgcagcacaccgtggttatctgaaggtcctctatacaccttgagaataaatcagttcatgatcaaaaaagcaaacc |
39678560 |
T |
 |
| Q |
215 |
agtgcatcaaatacagaaagtgcatgcttagtttatttttctatataaggaattttgcagggacgctaagagcccagaatatcatattatgagtttcttg |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39678561 |
agtgcatcgaatacagaaagtgcatgcttagtttatttttctatataaggaattttgcagggacgctaagagcccagaatatcatattatgagtttcttg |
39678660 |
T |
 |
| Q |
315 |
tctacgaggat |
325 |
Q |
| |
|
||||||||||| |
|
|
| T |
39678661 |
tctacgaggat |
39678671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 9 - 55
Target Start/End: Original strand, 39678280 - 39678326
Alignment:
| Q |
9 |
agaatattaaataagatattctaatatgatcgaaacaatattataaa |
55 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39678280 |
agaaaattaaataagatattctaatatgatcgaaataatattataaa |
39678326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University