View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21151_high_14 (Length: 313)
Name: NF21151_high_14
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21151_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 3084573 - 3084376
Alignment:
| Q |
1 |
tatgattacgacataacaaaattgtggggtactcatcttctgtaggataannnnnnngacaattctcttattttctcttcttttgggataaaagaataga |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3084573 |
tatgcttacgacataacaaaattgtggggtactcatcttctgtaggataatttttttgacaattctcttattttctcttcttttgggataaaagaataga |
3084474 |
T |
|
| Q |
101 |
gagggagagagaggcacaatgaaaatatatgaaagtgttgtcttaaaattgttatataaatatcatttccctattaagtaagtaagtattaacatggtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
3084473 |
gagggagagagaggcacaatgaaaatatatgaaagtgttgtcttaaaattgttatataaatatcattttcctattaagta----agtattaacatggtgc |
3084378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 191 - 272
Target Start/End: Complemental strand, 3084238 - 3084157
Alignment:
| Q |
191 |
aacatggtgcaaaaagctggggtgagtggttaattgtaggcatgctaatactcgtgcaagcacatgctcatttcaactagtg |
272 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3084238 |
aacatggtgcaagaagctggggtgagtggttaattgtaggcatgctaatactcgtgcaagcacatgctcatttcaactagtg |
3084157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 3078690 - 3078652
Alignment:
| Q |
1 |
tatgattacgacataacaaaattgtggggtactcatctt |
39 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3078690 |
tatgcttacgacataacaaaattgtggggtactcatctt |
3078652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University