View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21151_high_26 (Length: 227)
Name: NF21151_high_26
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21151_high_26 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 52763505 - 52763288
Alignment:
| Q |
1 |
catctccgccgccaaaatccaacgattttcagccaactcaaacaactgcttaaacctatctctaagaggaatactaactaataaaggatttgttcataca |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52763505 |
catctccgccgctaaaatccaacgattttcagccaattcaaacaactgcttaaacctatctctaagaggaatactacctaataaaggatttgttcataca |
52763406 |
T |
|
| Q |
101 |
aatgttttgagtccattaccaactacccttttttaattttcttcgaaccaactctctgtccctaatagactgctttatgtgtcactcatctgtcgttcca |
200 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52763405 |
gatgatttgagtccattaccaactacccttttttaattttcttcgaaccaactctctgtccctaatagactgctttatgtgtcactcatctgtcgttcca |
52763306 |
T |
|
| Q |
201 |
tgaagcttttccattaaa |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
52763305 |
tgaagcttttccattaaa |
52763288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University