View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21151_low_13 (Length: 322)
Name: NF21151_low_13
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21151_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 269; Significance: 1e-150; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 269; E-Value: 1e-150
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 16895673 - 16895365
Alignment:
| Q |
1 |
ctcttccttattttcttctcccatttctcttctatctctgcctcatattccacaacatgttctggcatagtgccgttccgacaccgcgccgacacgattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
16895673 |
ctcttccttattttcttctcccatttctcttctatctctgcctcatattccacaacatgttctggcatagtgccgttccgacaccgtgccgacacgattt |
16895574 |
T |
 |
| Q |
101 |
ccataaccgattttggtggcgtcggcgacggcaaaacgctgaactcaaaggcatttagggcagctatttataggattcagcacttaaggagacgtggtgg |
200 |
Q |
| |
|
||||||| ||||| || || ||||| ||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
16895573 |
ccataactgatttcggcggtgtcggagacggcaaaaccctgaactcaaaggcattcagagcagctatttataggattcagcacttaagaagacgtggtgg |
16895474 |
T |
 |
| Q |
201 |
cacgctcctttatgtgcctcctggtgtgtacttaacggagagcttcaatcttactagtcatatgactctttatcttgctgctggtgctgttattaaagcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16895473 |
cacgctcctttatgtgcctcctggtgtgtacttaacggagagcttcaatcttactagtcatatgactctttatcttgctgctggtgctgttattaaagcc |
16895374 |
T |
 |
| Q |
301 |
acacaggtt |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
16895373 |
acacaggtt |
16895365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 243 - 308
Target Start/End: Complemental strand, 39274966 - 39274901
Alignment:
| Q |
243 |
cttcaatcttactagtcatatgactctttatcttgctgctggtgctgttattaaagccacacaggt |
308 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
39274966 |
cttcaatcttactagtcatatgactcttcatcttgctgctggtgctgttatcaaagccacacaggt |
39274901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University