View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21151_low_14 (Length: 313)

Name: NF21151_low_14
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21151_low_14
NF21151_low_14
[»] chr4 (3 HSPs)
chr4 (1-202)||(3084376-3084573)
chr4 (191-272)||(3084157-3084238)
chr4 (1-39)||(3078652-3078690)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 3084573 - 3084376
Alignment:
1 tatgattacgacataacaaaattgtggggtactcatcttctgtaggataannnnnnngacaattctcttattttctcttcttttgggataaaagaataga 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||    
3084573 tatgcttacgacataacaaaattgtggggtactcatcttctgtaggataatttttttgacaattctcttattttctcttcttttgggataaaagaataga 3084474  T
101 gagggagagagaggcacaatgaaaatatatgaaagtgttgtcttaaaattgttatataaatatcatttccctattaagtaagtaagtattaacatggtgc 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    ||||||||||||||||    
3084473 gagggagagagaggcacaatgaaaatatatgaaagtgttgtcttaaaattgttatataaatatcattttcctattaagta----agtattaacatggtgc 3084378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 191 - 272
Target Start/End: Complemental strand, 3084238 - 3084157
Alignment:
191 aacatggtgcaaaaagctggggtgagtggttaattgtaggcatgctaatactcgtgcaagcacatgctcatttcaactagtg 272  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3084238 aacatggtgcaagaagctggggtgagtggttaattgtaggcatgctaatactcgtgcaagcacatgctcatttcaactagtg 3084157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 3078690 - 3078652
Alignment:
1 tatgattacgacataacaaaattgtggggtactcatctt 39  Q
    |||| ||||||||||||||||||||||||||||||||||    
3078690 tatgcttacgacataacaaaattgtggggtactcatctt 3078652  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University