View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21151_low_23 (Length: 245)
Name: NF21151_low_23
Description: NF21151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21151_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 33355195 - 33354956
Alignment:
| Q |
1 |
tatatgatgttcatgtttatgtccgtgtttgatactatgttggttataatttgtttaaattttaaagaaactttgatgttgatgcagagacatatgcaac |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33355195 |
tatatgatgttcatgtctatgtccgtgtttgatgctatgttggttataatttgtttaaattttaaagaaacttagatgttgatgcagagacatatgcaac |
33355096 |
T |
|
| Q |
101 |
ttggtgggttgcctcctagaaccagctacggtaagtgaatctgaaccaaatgcatcgatatattatttgttctattgcattgcagggtggtccatagaga |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33355095 |
ttggtgggttgcctccttgaaccagctacggtaagtgaatctgaaccaaatgcatcgatatattatttgttctattgcattgcagggtggtccacagaga |
33354996 |
T |
|
| Q |
201 |
gagcagctagccctgacaatattggattgggtggcctttg |
240 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33354995 |
gagcagctagccctcacaatattggattgggtggcctttg |
33354956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University