View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21153_high_1 (Length: 372)
Name: NF21153_high_1
Description: NF21153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21153_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 30 - 369
Target Start/End: Complemental strand, 37850443 - 37850108
Alignment:
| Q |
30 |
gcaaggtggtgctgttttctcgtccttgagtttgtctataaacggaagaagcgatgatgtagatcatagatacaaatccaatcaaaaagaagagaaggag |
129 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37850443 |
gcaaggtggtgctgttttctcttccttgagtttgtctataaacggaagaagcgatgatgtagatcatagatacaaatccaatcaaaaagaagagaaggag |
37850344 |
T |
 |
| Q |
130 |
aatattcaggttcatggatcgggtgctgtcaacatgaccaaacacctctggtctggtgcttttgccgctatggtctcaaggtctttacttctctatacaa |
229 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37850343 |
aatattcatgttcatggatcgggtgctgtcaacatgaccaaacacctctggtctggtgcttttgccgctatggtctcaaggtctttacttctctatacaa |
37850244 |
T |
 |
| Q |
230 |
tannnnnnnnnnnnnnnnnttctagtacttttctcttttccacaccctgctatattttgtcacacctttgcttctcatataaatatcatactgcattcat |
329 |
Q |
| |
|
|| || || ||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||||||||||||||| ||| |
|
|
| T |
37850243 |
taacaacaacacacacacattttattacttttctcttttccacacccttctatattttgtcacaccattgattctcatataaatatcatactg----cat |
37850148 |
T |
 |
| Q |
330 |
tcattcattttatttataggactgagtgaccaataccata |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37850147 |
tcattcattttatttataggactgagtgaccaataccata |
37850108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University