View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21153_high_5 (Length: 302)
Name: NF21153_high_5
Description: NF21153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21153_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 9e-67; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 152 - 292
Target Start/End: Original strand, 19243132 - 19243272
Alignment:
| Q |
152 |
atgaaattcctagcttaagtgcagtttcttggagtgtgatgatttctgaatatacgaaagtgggtgatgttgattcggctaaattgttcttcgatgaagc |
251 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19243132 |
atgaaattcctaacttaagtgcagtttcttggagtgtgatgatttctgaatatacgaaagtgggtgatgttgattcggctaaattgttcttcgatgaagc |
19243231 |
T |
|
| Q |
252 |
gcctgagaaggataaaggaatatgaggtgcaatggtctctg |
292 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
19243232 |
gcctgagaaggataaaggaatatggggtgcaatggtttctg |
19243272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 152 - 285
Target Start/End: Original strand, 19240101 - 19240234
Alignment:
| Q |
152 |
atgaaattcctagcttaagtgcagtttcttggagtgtgatgatttctgaatatacgaaagtgggtgatgttgattcggctaaattgttcttcgatgaagc |
251 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||| || | ||| ||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19240101 |
atgaaattcctagcttaaatgtggtttcttggagtgtgatgatctcgggttatgcgaaagtgggtgatgttgattcggctagattgttcttcgatgaagc |
19240200 |
T |
|
| Q |
252 |
gcctgagaaggataaaggaatatgaggtgcaatg |
285 |
Q |
| |
|
||||||||||||||| || ||||| ||||||||| |
|
|
| T |
19240201 |
gcctgagaaggataaggggatatggggtgcaatg |
19240234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 34 - 103
Target Start/End: Original strand, 19243014 - 19243083
Alignment:
| Q |
34 |
caagatttcattttctcagagcatgaataaaccttaaacacaattttatgtttggaccttaattatactc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19243014 |
caagatttcattttctcagagcatgaataagccttaaacacaattttatgtttggaccttaattatactc |
19243083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University