View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21154_low_3 (Length: 301)
Name: NF21154_low_3
Description: NF21154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21154_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 127 - 286
Target Start/End: Original strand, 36545191 - 36545350
Alignment:
| Q |
127 |
ttggtaaagaaagtaactatttctactagaacaaaggcctatttatagtagtaaaaagatttgacattgataggttatcatatcatgtacaactcaggta |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36545191 |
ttggtaaagaaagtaactatttctactagaacaaaggcctatttatagttctaaaaagatttgacattgataggttatcatatcatgtacaactcaggta |
36545290 |
T |
 |
| Q |
227 |
atctagtgctggcctttctttttggttttcaaattcttaatccctgtgtattgttgtaaa |
286 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36545291 |
atctagtgctggcctttcttttcggttttcaaattcttaatccctgtgtattgttgtaaa |
36545350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 18 - 130
Target Start/End: Original strand, 36544871 - 36544983
Alignment:
| Q |
18 |
agtacatcttattgaaatatgtgtagatgttagaggttttgaagaaattaaggtgtagaagctaacttcaacttatgcaagaaattttgtagtgaaagaa |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
36544871 |
agtacattttattgaaatatgtgtagatgttagaggttttgaagaaattaaggtgtagaagctaacttcaacttatgcaagaaattttgtagtgaaaaaa |
36544970 |
T |
 |
| Q |
118 |
tatcatttattgg |
130 |
Q |
| |
|
||||||||||||| |
|
|
| T |
36544971 |
tatcatttattgg |
36544983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University