View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21155_high_5 (Length: 201)

Name: NF21155_high_5
Description: NF21155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21155_high_5
NF21155_high_5
[»] chr5 (2 HSPs)
chr5 (18-97)||(27314392-27314471)
chr5 (116-188)||(27314760-27314830)
[»] chr3 (1 HSPs)
chr3 (121-158)||(42530816-42530853)


Alignment Details
Target: chr5 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 27314392 - 27314471
Alignment:
18 tgattcaatttagtttgcaatgactcttttggtttgtatttgtgagtggcttaagtattccttctatccactcatttgta 97  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
27314392 tgattcaatttagtttgcaatgactcttttggtttgtatttgtgagtggcttaagtattccttctatccactaatttgta 27314471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 116 - 188
Target Start/End: Original strand, 27314760 - 27314830
Alignment:
116 tcatattgattattctgattgattgcacttcttcccattttgactattattgatttaatacttctcccccttt 188  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||||| ||||||    
27314760 tcatattgattattctgattgattgcatttcttcccattttgactattattgatt--atacttctctcccttt 27314830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 158
Target Start/End: Original strand, 42530816 - 42530853
Alignment:
121 ttgattattctgattgattgcacttcttcccattttga 158  Q
    |||||| |||||||||||||||||||||||| ||||||    
42530816 ttgattcttctgattgattgcacttcttccccttttga 42530853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University