View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21155_high_5 (Length: 201)
Name: NF21155_high_5
Description: NF21155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21155_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 76; Significance: 2e-35; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 76; E-Value: 2e-35
Query Start/End: Original strand, 18 - 97
Target Start/End: Original strand, 27314392 - 27314471
Alignment:
| Q |
18 |
tgattcaatttagtttgcaatgactcttttggtttgtatttgtgagtggcttaagtattccttctatccactcatttgta |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27314392 |
tgattcaatttagtttgcaatgactcttttggtttgtatttgtgagtggcttaagtattccttctatccactaatttgta |
27314471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 116 - 188
Target Start/End: Original strand, 27314760 - 27314830
Alignment:
| Q |
116 |
tcatattgattattctgattgattgcacttcttcccattttgactattattgatttaatacttctcccccttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
27314760 |
tcatattgattattctgattgattgcatttcttcccattttgactattattgatt--atacttctctcccttt |
27314830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 121 - 158
Target Start/End: Original strand, 42530816 - 42530853
Alignment:
| Q |
121 |
ttgattattctgattgattgcacttcttcccattttga |
158 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
42530816 |
ttgattcttctgattgattgcacttcttccccttttga |
42530853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University