View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21155_low_5 (Length: 237)
Name: NF21155_low_5
Description: NF21155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21155_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 37004528 - 37004410
Alignment:
| Q |
104 |
ttgagaagttgtgaggatgcaaatacaaatgtgtggtagccnnnnnnntctt-ctatcaattgtcatggtcccaaaaatataccaaagtcgagagatttc |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004528 |
ttgagaagttgtgaggatgcaaatacaaatgtgtggtagccaaaaaaatctttctatcaattgtcatggtcccaaaaatataccaaagtcgagagatttc |
37004429 |
T |
 |
| Q |
203 |
aaataatacgggacaaaca |
221 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37004428 |
aaataatacgggacaaaca |
37004410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 37004631 - 37004594
Alignment:
| Q |
1 |
ttttacgcaaagtcatctcctccccttcaaactcgtaa |
38 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37004631 |
ttttacgcaaagtcatctcctccccttcaaactcgtaa |
37004594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University